Research Article
Print
Research Article
Phylogenetic relationship of Japanese Podismini species (Orthoptera: Acrididae: Melanoplinae) inferred from a partial sequence of cytochrome c oxidase subunit I gene
expand article infoBeata Grzywacz§, Haruki Tatsuta§
‡ Polish Academy of Sciences, Krakow, Poland
§ University of the Ryukyus, Okinawa, Japan
Open Access

Abstract

Members of the tribe Podismini (Orthoptera: Acrididae: Melanoplinae) are distributed mainly in Eurasia and the western and eastern regions of North America. The primary aim of this study is to explore the phylogenetic relationship of Japanese Podismini grasshoppers by comparing partial sequences of cytochrome c oxidase subunit I (COI) mitochondrial gene. Forty podismine species (including nineteen Japanese species) and thirty-seven species from other tribes of the Melanoplinae (Dactylotini, Dichroplini, Melanoplini, and Jivarini) were used in the analyses. All the Japanese Podismini, except Anapodisma, were placed in a well-supported subclade. However, our results did not correspond with the classification on the basis of morphological similarity for the status of Tonkinacridina. This group of Japanese species constituted a single clade with other species of Miramellina and Podismina, while Eurasian continental species of Tonkinacridina were placed in other separate clades. This incongruence might have resulted from historical migratory events between continent and ancient islands and subsequent convergent/parallel evolution in morphology. Some remarks on phylogenetic positions in Podismini and other tribes were also made in terms of reconstructed phylogeny.

Key words

grasshoppers, polymorphism, mitochondrial DNA

Introduction

The tribe Podismini Jacobson, 1905 is one of the five tribes belonging to the acridid subfamily Melanoplinae Scudder, 1897 (Cigliano et al. 2017). Podismini genera are distributed in the Palearctic and Nearctic region (Vickery 1987). They usually occur in grassland and scrub formations. Although morphology is rather variable between species, most species are clearly definable (Ito 2015). According to morphological features, Podismini is currently divided into three subtribes: Miramellina (Rehn & Randell, 1963), Podismina (Jacobson, 1905), and Tonkinacridina (Ito, 2015). The genus group Bradynotae (Rehn & Randell, 1963) and another 21 genera have also been considered as members of this tribe, but they have not yet been included in the subtribes (Cigliano et al. 2017).

Because of the substantial variability in morphology and even in karyotype, the taxonomy of Podismini has been excessively confused. Based on the reexamination of characters, Japanese Podismini consists of 22 species in nine genera (Ito 2015), while the phylogenetic relationship between species in the tribe is still ambiguous. The first molecular study of Podismini examined one mitochondrial gene (COII) and three ribosomal nuclear and mitochondrial genes (ITS1, 12S, and 16S) for 25 species of Podismini (Chintauan-Marquier et al. 2014). In this study, nine Japanese species of seven genera [Parapodisma dairisama (Scudder, 1897), P. mikado (Bolivar, 1890), P. subastris Huang, 1983; Sinopodisma punctata Mistshenko, 1954; Ognevia longipennis (Shiraki, 1910); Podisma kanoi (Storozhenko, 1994); Zubovskya koeppeni parvula (Ikonnikov, 1911); Fruhstorferiola okinawaensis (Shiraki, 1930); Tonkinacris sp. (Carl, 1916)] were also examined. Four of seven genera (Parapodisma Mistshenko, 1947, Sinopodisma Chang, 1940, Tonkinacris Carl, 1916, Fruhstorferiola Willemse, 1921) constituted a clade with moderate statistical support, two of seven (Podisma Berthold, 1827, Ognevia Ikonnikov, 1911) composed another clade, and Zubovskya Dovnar-Zapolsky, 1932 did not comprise a clade with any other genera.

The Japanese archipelago is composed of a multitude of smaller islands in addition to the four main islands (Hokkaido, Honshu, Kyushu, and Shikoku). The isolation of the Japanese archipelago from the Eurasian continent presumably began in Miocene (ca. 23 Myr ago), and the present form of the archipelago was reached in the approximate end of Pleistocene (Iijima and Tada 1990, Tada 1994, Yonekura et al. 2001). Interestingly, land bridges between the continent and some of the islands were formed at least three times during geochronologic periods between the Pliocene and Pleistocene as a result of changes in sea level during ice ages (Dobson and Kawamura 1998), which may have permitted back-and-force movement of animals via the bridges. These complex geological events have probably shaped the present fauna and flora in Japan. The present Japanese Podismini had also presumably been derived in part from continental species group which evolved uniquely at a new place.

The Japanese archipelago in broad sense consists of Hokkaido, Honshu, Shikoku, Kyushu, south Kuril Islands, and chain of islands extending from southwestern Kyushu to northern Taiwan (i.e. “Nansei Islands”). The brief distribution of nine genera in Podismini is shown in Fig. 1. Three of nine genera, Fruhstorferiola, Sinopodisma, and Tonkinacris are distributed only in Nansei Islands, presumably derived directly from continental species of the same genera. The genus Anapodisma Dovnar-Zapolskii, 1933 is found only in Tsushima Island, the southern vicinities of Korean Peninsula. The distribution of Prumna Motschulsky, 1859, Zubovskya, and Podisma is localized in a northern part of Japan (central - northern Honshu, Hokkaido and Kunashir Island) and the habitat tends to be highly fragmented especially in mountain districts. Ognevia shows the broadest distribution range among Japanese Podismini and is distributed in high altitude areas. Although other genera are apterous or have reduced forewings, flight organs are fully developed in this genus. The genus Parapodisma comprises 11 species (50% of the Japanese podismine species) including two subspecies in Japan, and shows a variety of morphology such as body colors, genitalic characters and forewings, which has sometimes confounded their taxonomic status (Ito 2015). Although Vickery (1977) suggested that Sinopodisma, Fruhstorferiola and Parapodisma comprise Miramellina together with Zubovskya and Miramella Dovnar-Zapolskii, 1933, Ito (2015) proposed that the first three genera with Tonkinacris should be settled in a new subtribe, Tonkinacridina based on the cladistic assessment of 23 morphological traits.

The principal aim of the present study is to examine whether Ito’s (2015) hypothesis still holds if the relationship is assessed using mitochondrial DNA sequences. We utilized a partial sequence of the cytochrome c oxidase subunit I (COI) mitochondrial gene for this purpose because the sequence is used as standard in DNA barcoding and thus is feasible for comparing species other than Japanese Podismini. In order to test the hypothesis of a close affinity between all Japanese taxa, other Melanoplinae species from Eurasia and America were also drawn from GenBank and included in the analysis.

Figure 1. 

A map of Japan with the distribution of nine genera of Japanese Podismini.

Materials and methods

Taxa studied

— A total of 82 species and subspecies were included in the analysis. All genetic sequences were acquired from GenBank except Podismini species in Japan (Table 1). The in-group consisted of 20 Podismini species and subspecies from Japan (new data) and 21 species from Eurasia and America. We included members of four other tribes of Melanoplinae: Melanoplini (19 species), Dactylotini (3 species), Dichroplini (13 species), and Jivarini (2 species). As an outgroup, we included four species of subfamily Catantopinae [Xenocatantops humilis (Serville, 1838), Catantops erubescens (Walker, 1870), Diabolocatantops innotabilis (Walker, 1870), and Goniaea vocans (Fabricius, 1775)]. We did not include Japanese species of the genus Ognevia; instead, an existing sequence for O. longipennis from China was examined in this paper (Lü and Huang 2012).

Taxonomic information and GenBank accession numbers for taxa included in this study.

Taxa Sampling locality and year Accession No. Reference
outgroup
Subfamily: Catantopinae
Xenocatantops humilis (Serville, 1838) China EU366111 Wang and Jiang (unpublished)
Catantops erubescens (Walker, 1870) Pakistan KJ672128 Nazir et al. (unpublished)
Diabolocatantops innotabilis (Walker, 1870) Pakistan KJ672135 Nazir et al. (unpublished)
Goniaea vocans (Fabricius, 1775) Australia JX033911 Chapco 2013
Subfamily: Melanoplinae
Tribe: Dactylotini
Dactylotum bicolor bicolor Charpentier, 1845 North America KJ531421 Woller et al. 2014
Liladownsia fraile Fontana, Mariño-Pérez, Woller & Song, 2014 North America KJ531423 Woller et al. 2014
Perixerus squamipennis Gerstaecker, 1873 North America KJ531427 Woller et al. 2014
Tribe: Dichroplini
Atrachelacris unicolor Giglio-Tos, 1894 South America FJ829334 Dinghi et al. 2009
Atrachelacris gramineus Bruner, 1911 South America AY014360 Amédégnato et al. 2003
Baeacris pseudopunctulata (Ronderos, 1964) South America, Argentina DQ083452 Colombo et al. 2005
Chlorus bolivianus Brunner, 1913 South America FJ829333 Dinghi et al. 2009
Dichromatos lilloanus (Liebermann, 1948) South America FJ829336 Dinghi et al. 2009
Dichroplus obscurus Bruner, 1900 South America DQ084357 Dinghi et al. 2009
Dichroplus pratensis Brunner, 1900 South America, Argentina DQ083459 Colombo et al. 2005
Leiotettix pulcher Rehn, 1913 South America, Argentina DQ083464 Colombo et al. 2005
Neopedies noroestensis Ronderos, 1991 South America AF539852 Amédégnato et al. 2003
Pseudoscopas nigrigena (Rehn, 1913) South America FJ829342 Dinghi et al. 2009
Ronderosia bergii (Stål, 1878) South America, Argentina DQ083467 Colombo et al. 2005
Ronderosia forcipata (Rehn, 1918) South America, Argentina DQ083468 Colombo et al. 2005
Scotussa daguerrei Liebermann, 1947 South America, Argentina DQ083469 Colombo et al. 2005
Tribe: Jivarini
Jivarus americanus Giglio-Tos, 1898 South America DQ389233 Chapco 2006
Jivarus gurneyi Ronderos, 1979 South America DQ389231 Chapco 2006
Tribe: Melanoplini
Hypochlora alba (Dodge, 1876) North America, USA AF260548 Chapco et al. 2001
Melanoplus bivittatus (Say, 1825) North America, Canada KR141481 Hebert et al. 2016
Melanoplus borealis (Fieber, 1853) North America, Canada KR142429 Hebert et al. 2016
Melanoplus bowditchi Scudder, 1878 North America, Canada KM535226 Dewaard et al. (unpublished)
Melanoplus bruneri Scudder, 1897 North America, Canada KM535553 Dewaard et al. (unpublished)
Melanoplus cinereus Scudder, 1878 North America, Canada KR141925 Hebert et al. 2016
Melanoplus dawsoni (Scudder, 1875) North America, Canada KM537453 Dewaard et al. (unpublished)
Melanoplus deceptus Morse, 1904 North America, Canada KR140464 Hebert et al. 2016
Melanoplus differentialis (Thomas, 1865) North America KJ531425 Woller et al. 2014
Melanoplus femurrubrum (De Geer, 1773) North America, Canada KM536630 Dewaard et al. (unpublished)
Melanoplus gladstoni Scudder, 1897 North America, Canada KR140625 Hebert et al. 2016
Melanoplus infantilis Scudder, 1878 North America, Canada KM537809 Dewaard et al. (unpublished)
Melanoplus mexicanus (Saussure, 1861) North America KJ531426 Woller et al. 2014
Melanoplus montanus (Thomas, 1873) North America, Canada KM536558 Dewaard et al. (unpublished)
Melanoplus oregonensis (Thomas, 1875) North America, Canada KR140837 Hebert et al. 2016
Melanoplus packardii Scudder, 1878 North America, Canada KM537414 Dewaard et al. (unpublished)
Melanoplus punctulatus (Uhler, 1862) North America, Canada KR140511 Hebert et al. 2016
Melanoplus sanguinipes (Fabricius, 1798) North America, Canada KR143225 Hebert et al. 2016
Phoetaliotes nebrascensis (Thomas, 1872) North America, Canada KM535800 Dewaard et al. (unpublished)
Tribe: Podismini
Subtribe: Miramellina
Anapodisma beybienkoi Rentz & Miller, 1971 Tsushima, Nagasaki, Japan, 2016 KY558890 This study
Anapodisma miramae Dovnar-Zapolskij, 1932 China KM362650 Kang et al. 2016
Zubovskya koeppeni parvula (Ikonnikov, 1911) Mt. Daisetsu, Hokkaido, Japan, 2015 KX440513 This study
Zubovskya koeppeni parvula (Ikonnikov, 1911) Mt. Daisetsu, Hokkaido, Japan, 2015 KX440514 This study
Zubovskya koeppeni parvula (Ikonnikov, 1911) Mt. Daisetsu, Hokkaido, Japan, 2015 KX440515 This study
Zubovskya koeppeni parvula (Ikonnikov, 1911) Mt. Daisetsu, Hokkaido, Japan, 2015 KX440516 This study
Subtribe: Podismina
Ognevia longipennis (Shiraki, 1910) China JQ301452 Lü and Huang 2012
Ognevia sergii Ikonnikov, 1911 Russia KC261364 Bugrov et al. (unpublished)
Podisma kanoi Storozhenko, 1994 Mt. Yokote, Nagano, Japan, 2014 KX440484 This study
Podisma kanoi Storozhenko, 1994 Mt. Yokote, Nagano, Japan, 2014 KX440485 This study
Podisma sapporensis Shiraki, 1910 Kamishihoro, Hokkaido, Japan, 2015 KY558881 This study
Podisma sapporensis Shiraki, 1910 Nukabira, Hokkaido, Japan, 2015 KY558882 This study
Podisma tyatiensis Bugrov & Sergeev, 1997 Russia KC261368 Bugrov et al. (unpublished)
Yunnanacris yunnaneus (Ramme, 1939) China KX223964 Guan and Xu (unpublished)
Subtribe: Tonkinacridina
Fruhstorferiola huayinensis Bi & Xia, 1980 China KC139873 Huang et al. 2013
Fruhstorferiola kulinga (Chang, 1940) China KC139885 Huang et al. 2013
Fruhstorferiola okinawaensis (Shiraki, 1930) Kunigami, Okinawa, Japan, 1998 KX440482 This study
Fruhstorferiola okinawaensis (Shiraki, 1930) Kunigami, Okinawa, Japan, 1998 KY558871 This study
Fruhstorferiola tonkinensis (Willemse, 1921) China KC139890 Huang et al. 2013
Parapodisma awagatakensis Ishikawa, 1998 Kanaya, Shizuoka, Japan, 2015 KY558873 This study
Parapodisma awagatakensis Ishikawa, 1998 Kanaya, Shizuoka, Japan, 2015 KY558874 This study
Parapodisma caelestis Tominaga & Ishikawa, 2001 Mt. Kamikouchi, Nagano, Japan, 2016 KY558875 This study
Parapodisma caelestis Tominaga & Ishikawa, 2001 Mt. Kamikouchi, Nagano, Japan, 2016 KY558876 This study
Parapodisma caelestis Tominaga & Ishikawa, 2001 Mt. Kamikouchi, Nagano, Japan, 2016 KY558877 This study
Parapodisma dairisama (Scudder, 1897) Kofu, Tottori, Japan, 2005 KX440478 This study
Parapodisma dairisama (Scudder, 1897) Kofu, Tottori, Japan, 2005 KX440479 This study
Parapodisma dairisama (Scudder, 1897) Kofu, Tottori, Japan, 2005 KX440480 This study
Parapodisma dairisama (Scudder, 1897) Kofu, Tottori, Japan, 2005 KX440481 This study
Parapodisma mikado (Bolívar, 1890) Kami-sugo, Furukawa, Japan KY558878 This study
Parapodisma niihamensis hiurai Tominaga & Kano, 1987 Kawachi-nagano, Osaka, Japan, 2015 KX440483 This study
Parapodisma niihamensis niihamensis Inoue, 1979 Yoshinogawa, Tokushima, Japan, 2015 KX440486 This study
Parapodisma niihamensis niihamensis Inoue, 1979 Yoshinogawa, Tokushima, Japan, 2015 KX440487 This study
Parapodisma niihamensis niihamensis Inoue, 1979 Yoshinogawa, Tokushima, Japan, 2015 KX440488 This study
Parapodisma setouchiensis 1 Inoue, 1979 Mima, Tokushima, Japan, 2015 KX440498 This study
Parapodisma setouchiensis 1 Inoue, 1979 Mima, Tokushima, Japan, 2015 KX440499 This study
Parapodisma setouchiensis 2 Inoue, 1979 Minamiasakawa, Hachioji, Japan, 2015 KX440489 This study
Parapodisma setouchiensis 2 Inoue, 1979 Sefuriyama, Fukuoka, Japan, 2015 KX440490 This study
Parapodisma setouchiensis 2 Inoue, 1979 Sefuriyama, Fukuoka, Japan, 2015 KX440491 This study
Parapodisma setouchiensis 3 Inoue, 1979 Toyooka, Hyogo, Japan, 2014 KY558872 This study
Parapodisma subastris 1 Huang, 1983 Oe, Kyoto, Japan, 2014 KX440494 This study
Parapodisma subastris 1 Huang, 1983 Oe, Kyoto, Japan, 2014 KX440495 This study
Parapodisma subastris 2 Huang, 1983 Oe, Kyoto, Japan, 2014 KX440496 This study
Parapodisma subastris 2 Huang, 1983 Oe, Kyoto, Japan, 2014 KX440497 This study
Parapodisma subastris 2 Huang, 1983 Oe, Kyoto, Japan, 2014 KX440492 This study
Parapodisma subastris 2 Huang, 1983 Oe, Kyoto, Japan, 2014 KX440493 This study
Parapodisma tenryuensis 1 Kobayashi, 1983 Oyama, Shizuoka, Japan, 2015 KY558883 This study
Parapodisma tenryuensis 1 Kobayashi, 1983 Oyama, Shizuoka, Japan, 2015 KY558884 This study
Parapodisma tenryuensis 2 Kobayashi, 1983 Mt. Chausu, Shizuoka, Japan, 2016 KY558885 This study
Parapodisma tenryuensis 2 Kobayashi, 1983 Mt. Chausu, Shizuoka, Japan, 2016 KY558886 This study
Parapodisma tenryuensis 2 Kobayashi, 1983 Mt. Chausu, Shizuoka, Japan, 2016 KY558887 This study
Parapodisma yasumatsui Yamasaki, 1980 Sefuriyama, Fukuoka, Japan, 2015 KX440500 This study
Parapodisma yasumatsui Yamasaki, 1980 Mitsuse, Saga, Japan, 2015 KX440501 This study
Sinopodisma aurata Ito, 1999 Kohama Island, Okinawa, Japan, 2016 KY558888 This study
Sinopodisma aurata Ito, 1999 Kohama Island, Okinawa, Japan, 2016 KY558889 This study
Sinopodisma houshana Huang, 1982 China KC139919 Huang et al. 2013
Sinopodisma kodamae (Shiraki, 1910) Kukuan, Taiwan, 1998 KX440502 This study
Sinopodisma kodamae (Shiraki, 1910) Kukuan, Taiwan, 1998 KX440503 This study
Sinopodisma lofaoshana (Tinkham, 1936) China KC139936 Huang et al. 2013
Sinopodisma lushiensis Zhang, 1994 China KC139925 Huang et al. 2013
Sinopodisma punctata Mistshenko, 1954 Tatsugo, Kagoshima, Japan, 1997 KX440504 This study
Sinopodisma punctata Mistshenko, 1954 Tatsugo, Kagoshima, Japan, 1997 KX440505 This study
Sinopodisma punctata Mistshenko, 1954 Tatsugo, Kagoshima, Japan, 1997 KX440506 This study
Sinopodisma punctata Mistshenko, 1954 Tatsugo, Kagoshima, Japan, 1997 KX440507 This study
Sinopodisma punctata Mistshenko, 1954 Tatsugo, Kagoshima, Japan, 1997 KX440508 This study
Sinopodisma punctata Mistshenko, 1954 Tatsugo, Kagoshima, Japan, 1997 KX440509 This study
Sinopodisma rostellocerna You, 1980 China KC139947 Huang et al. 2013
Sinopodisma tsinlingensis Zheng, 1974 China KC139903 Huang et al. 2013
Sinopodisma wulingshanensis Bi, Huang & Liu, 1992 China KC139909 Huang et al. 2013
Tonkinacris ruficerus Ito, 1999 Kunigami, Okinawa, Japan, 1998 KX440510 This study
Tonkinacris ruficerus Ito, 1999 Kunigami, Okinawa, Japan, 1998 KX440511 This study
Tonkinacris yaeyamaensis Ito, 1999 Mt. Omoto, Okinawa, Japan, 1998 KX440512 This study
genus group Bradynotae
Asemoplus montanus (Bruner, 1885) North America, Canada KM535587 Dewaard et al. (unpublished)
Bradynotes obesa (Thomas, 1872) North America KJ531419 Woller et al. 2014
Other members of Podismini – do not assign into any subtribe
Prumna arctica (Zhang & Jin, 1985) China KC139971 Huang et al. 2013
Prumna fauriei (Bolívar, 1890) Mt. Gassan, Yamagata, Japan, 2014 KY558879 This study
Prumna fauriei (Bolívar, 1890) Mt. Gassan, Yamagata, Japan, 2014 KY558880 This study
Prumna mandshurica Ramme, 1939 China FJ531676 Zhao et al. (unpublished)
Prumna primnoa (Motschulsky, 1846) Russia KX272717 Sukhikh et al. (unpublished)
Qinlingacris choui Li, Wu & Feng, 1991 China FJ531684 Zhao et al. (unpublished)

DNA extraction, amplification, and sequencing

— Total genomic DNA was extracted with the DNeasy Tissue Kit (QIAGEN, Hilden, Germany). Partial gene sequences were amplified by PCR using the following primers: forward UEA7 (TACAGTTGGAATAGACGTTGATAC) and reverse UEA10 (TCCAATGCACTAATCTGCCATATTA) (Lunt et al. 1996). PCR was conducted in a 20 µl volume containing 1 µl of DNA, 2 µl 10 × Ex Taq Buffer (Mg2+ free; Takara Bio Inc., Shiga, Japan) with 10 µM each primer, 10 mM dNTPs, 25 mM MgCl2, and 5 U/µl of Ex Taq polymerase (Takara Bio Inc., Shiga, Japan). The mitochondrial COI fragment was amplified under the following temperature profile: initial activation at 94 °C for 3 min, 30 cycles of denaturation at 94 °C for 1 min, annealing at 45 °C for 1 min, and elongation at 72 °C for 2 min, and a final elongation step at 72 °C for 7 min. PCR products were purified by using the NucleoSpin Extract II kit (Macherey-Nagel, Düren, Germany). Samples were sequenced in both directions by using the same primers as those used for PCR and the chain termination reaction method (Sanger et al. 1977). The sequencing was carried out in a total volume of 10 µl by using the Genome Lab Dye Terminator Cycle Sequencing with Quick Start Kit (Beckman Coulter, Brea, California, USA), with a cycle-sequencing profile of 40 cycles of 96 °C for 20 s, 50 °C for 20 s, and 60 °C for 3 min. Sequencing was performed using GenomeLab GeXPTM (Beckman Coulter, Brea, California, USA) at the Laboratory of Entomology in the Faculty of Agriculture, University of the Ryukyus, Japan. Sequences were deposited in GenBank under the accession numbers provided in Table 1.

Sequence alignment and phylogenetic analyses

— DNA sequences were aligned by using MUSCLE (Edgar 2004) with default parameters. In order to identify numts (Bensasson et al. 2001, Song et al. 2008), mitochondrial COI sequences were translated into amino acid sequences with MEGA 6 (Tamura et al. 2013) using the standard invertebrate mitochondrial genetic code. The substitution model of evolution was estimated by using the program jModelTest (Guindon and Gascuel 2003, Darriba et al. 2013). The Akaike information criterion was preferred over the hierarchical likelihood ratio test to compare the various models as recommended by Posada and Buckley (2004). The data matrices were subjected to Bayesian analysis (BI) with MrBayes v3.1. (Huelsenbeck and Ronquist 2001, Huelsenbeck et al. 2001). Bayesian analyses were performed with 10 000 000 generations, with a sampling of trees every 100 generations. Likelihood values were observed with Tracer v.1.4 (Rambaut and Drummond 2007); all the trees created before stability in likelihood values were discarded as a ‘burn-in’ (first 1200 trees). Maximum likelihood (ML) analysis was implemented in Phyml (Guindon and Gascuel 2003). For the bootstrapping analyses 1000 pseudoreplicates were generated. FigTree 1.4.0 (Rambaut and Drummond 2012) was used to visualize the trees.

Results

The total alignment of the COI gene consisted of 646 bp including 53% variable sites and 48% parsimony-informative sites. The analysis of the partial mitochondrial COI gene amplified from 59 individuals revealed 20 different haplotypes. Among them individuals were identical for 14 species except Parapodisma subastris, P. setouchiensis, and P. tenryuensis. The model F81 + G (gamma distribution shape parameter G = 0.6220) was determined to be the most justified.

The Bayesian inference and maximum likelihood analyses resulted in similar trees, the only differences between them being the degree of statistical support for the recovered nodes (Fig. 1). Nodal supports were generally poor across all backbone nodes. ML bootstrap percentages were lower than BI posterior probabilities. The relationship between Podismini and the related tribes were not fully resolved and varied depending on the nodes.

Melanoplinae were divided into six distinctive lineages and appeared as a polytomy of four clades (II – VI). Dactylotini (I) was placed as sister to the other five lineages. The second and third lineages (II and III) consisted of two genera (seven species) and one genus (three species) of Podismini, respectively. The fourth clade (IV) clustered the genera of Dichroplini. Within clade five (V), Melanoplini formed a monophyletic group with strong support [posterior probability (PP) = 1.00, bootstrap value (BV) = 77]. The sixth clade (VI) was constituted of the rest of the members of Podismini and Jivarini.

Thirteen genera of Podismini included in this study formed three separate clades. The Japanese Podismini, except Anapodisma beybienkoi Rentz & Miller, 1971, were placed in a well supported subclade with high nodal support (PP = 1.00, BV = 100) within clade VI. Nine species of Sinopodisma and four species of Fruhstorferiola included in the analysis nested in different clades. The majority of Podismini species formed clade VI together with Jivarini species. The basal relationships within clade VI were not resolved. Clade VI consisted of 13 branches with a single terminal taxon: nine species of Parapodisma, Bradynotes obesa (Thomas, 1827), Podisma tyatiensis Bugrov & Sergeev, 1997, Qinlingacris choui Li & Feng, 1991 and Asemoplus montanus (Bruner, 1885), and five subclades including members of three podismine subtribes. Tonkinacridina comprising Parapodisma, Tonkinacris, Fruhstorferiola and Sinopodisma did not constitute a single clade. Among 11 species of Parapodisma, P. tenryuensis Kobayashi, 1983 (two haplotypes), P. caelestis Tominaga & Ishikawa, 2001, P. mikado, and P. awagatakensis Ishikawa, 1998 were clustered together with moderate statistical support (Fig. 1).

Figure 2. 

Phylogenetic tree of Podismini based on the Bayesian analysis (BI) of concatenated COI sequences. BI posterior probability (PP) and maximum likelihood bootstrap values (BV) are shown near resolved branches (only support values above 50% are shown) as PP/BV. The respective clades are marked with a square and Roman numeral. We examined Ognevia longipennis from China because of the availability and thus did not treat this specimen as Japanese Podismini (see also text). Light green frames denote the Japanese Podismini analyzed in the present study.

Discussion

The present study obtained some interesting results with respect to the relationships within Japanese Podismini. The subclade of Japanese Podismini within clade VI (indicated with light green frames in Fig. 1) included genera which have been attributed to three podismine subtribes, but Tonkinacridina did not form a single clade. Two different methodological inferences on phylogeny (BI, ML) yielded mostly congruent nodes, but the trees were poorly resolved (Fig. 1). Most taxa were determined within a large polytomy of Podismini, in which only a few clades have been recovered. Support remained generally low for the deeper nodes, as was expected for a phylogeny constructed using COI only, but some more derived nodes had higher values (Fig. 1).

Our results are compared with tree inferred by Chintauan-Marquier et al. (2014) who were the first to show molecular phylogeny of Eurasian Podismini including nine Japanese species. The most important finding is that Podismini did not constitute monophyly as previously suggested in Chintauan-Marquier et al. (2014), but there are some incongruent patterns between the two. In the present results, most of the species of Japanese Podismini, except Anapodisma, constituted a single clade (Fig. 1), whereas species belonging to Podismina and Miramellina constituted separate clades from Tonkinacridina in the previous molecular study (Chintauan-Marquier et al. 2014). Although the statistical support was not very strong, a monophyly of Tonkinacridina was supported in the previous study, a view concordant with morphological inspection (Ito 2015). On the contrary, our data placed the continental species of Tonkinacridina in different clades (clade II and III in Fig. 1) from Japanese Tonkinacridina. Of course, strict comparisons between these studies are impossible at this stage since continental Tonkinacridina was not included in the previous dataset (Chintauan-Marquier et al. 2014). The view of monophyly in Tonkinacridina is quite doubtful. We can postulate that the observed continental and Japanese species of Tonkinacridina assigned in different clusters reflect somewhat historical migration events coupled with geological processes described above and subsequent convergent/parallel evolution has eventually accumulated in morphology. This conjecture could be evaluated by estimating coalescent time of clades using a mitochondrial clock.

In the genera compared, Parapodisma is particularly interesting because this includes a vast variety of morphological variation in genital and external characters (Kawakami 1999, Kawakami and Tatsuta 2010), while almost no variation in karyotype exists in contrast to morphology (Inoue 1985). Even in the same species, various forms in forewings and body colors are often found and thus have caused synonymous species/subspecies (Kawakami 1999). This taxonomic disorder still continues in this group partly because there is no robust phylogenetic tree that enables to disentangle “genuine” relationships from homoplasy in morphology. Unfortunately, most species constituted polytomy because of a lack of statistical power, a subclade comprised of closely related species, Parapodisma mikado, P. tenryuensis, P. caelestis, and P. awagatakensis was detected (Fig. 1). While P. mikado shows an extended distribution from vicinities of northern Japan and Russia such as Sakhalin, Kunashir, and Hokkaido to the middle of Honshu, the other three species are distributed in narrower regions in Honshu. In particular, populations of P. caelestis are limited to narrow habitats such as flower fields with a variety of wild grass and alpine flora on the top of mountains and P. awagatakensis inhabits patchy forest edges with very low population density; thus are considered to be vulnerable to unexpected environmental degradation. According to the cladistic assessment in morphology, P. awagatakensis was clustered together with P. mikado and P. dairisama, whereas P. tenryuensis constituted holophyly with P. caelestis and P. takeii (Takei, 1914) (this species is not included in our study) (Ito 2015), a result dissimilar to the present molecular relationship. Rigorous character sampling with additional molecular data is definitely required for resolving the complex relationship between morphological and genetic similarity. We also have to pay attention to possible hybridization between partly sympatric species, while no clear evidence for this has been obtained even in closely related species (Kawakami and Tatsuta 2010).

The genus Sinopodisma emerged as a highly paraphyletic group in which species did not appear closely related and nested in different clades. Likewise, although Sinopodisma punctata resembles S. kodamae (Shiraki, 1910) in several morphological features such as body color and genital appendages in comparison with S. aurata Ito, 1999, the inferred tree supports the closer relationship between S. aurata and S. kodamae. Furthermore, most of the continental species of Sinopodisma are distinguished from S. punctata and S. aurata in respect of the features in pronotum and cerci (Ito 2015). We postulate that the morphological similarities within Sinopodisma are the result of convergent evolution; further intensive studies based on molecular data are definitely necessary for the reliable underpinning of phylogenetic relationships.

The present investigation generated additional evidence for the relationships within Melanoplinae. In present trees, Dichroplini species were recovered as a monophyletic group, in agreement with the analysis of Chapco (2006) and Woller et al. (2014). On the other hand, Chintauan-Marquier et al. (2011) found the paraphyly of Dichroplini. In our analysis, Dactylotini and Melanoplini species each formed a monophyletic clade. Previous studies of Dactylotini including Hesperotettix viridis Thomas, 1872 discovered that this tribe is paraphyletic (Chapco 2006, Chintauan-Marquier et al. 2011, Woller et al. 2014). The prior analysis of the melanopline tribes placed Jivarini in a basal position in the subfamily (Amédégnato et al. 2003, Woller et al. 2014). In our results, Jivarini species were clustered together with Podismini representatives. Different studies (Litzenberger and Chapco 2001, Chintauan-Marquier et al. 2014, Woller et al. 2014) recovered Podismini as a monophyletic group, while Litzenberger and Chapco (2003) hypothesized a paraphyly of Podismini.

Although a single mitochondrial gene may lead to a half answer for the whole picture of relationships of higher taxa, the present study provides some significant implications of phylogenetic position. One of the great merits of this study is that the gene has extensively been used for DNA barcoding studies in insects, including grasshoppers, which enables us to examine a store of sequences in a global database (Cameron 2014). The selected mitochondrial COI gene allowed us to estimate intra- and inter-species relationships because of the presence of both variable and conserved regions as well as a heterogeneous evolutionary rate across the gene (Lunt et al. 1996). Simultaneously, we also should keep in mind that the shorter COI gene sequences may include paralogous nuclear mitochondrial pseudogenes (numts) that are apt to induce incorrect inference for phylogenetic relationships (Song et al. 2008, 2014). We need further investigations with orthologous genes for elucidating the distinct phylogenetic position of taxa of interest.

Acknowledgments

We are greatly indebted to Yasushi Kawakami, Keiichiro Shikata, Yoshikazu C. Sugano, Shin-ichi Akimoto, Koji Mizota, Masakazu Sano, Yasushi Sato, Takeshi Sasaki, Chiharu Koshio, and Shin-ichi Kudo for their help in collecting materials. Thanks are also due to Gen Ito for enthusiastic discussions and providing valuable materials and documents. Collecting materials at special protection zone in Daisetsuzan National Park and in Southern Alps National Park were approved by the Ministry of Environment of Japan (Nos. 1508181, 1605174, 1605023, 1607014). This work has been supported in part by JSPS KAKENHI Grant Numbers 15F15762, 25291088, and 25304014 to Haruki Tatsuta and Beata Grzywacz.

References

  • Amédégnato C, Chapco W, Litzenberger G (2003) Out of South America? Additional evidence for a southern origin of melanoplinae grasshoppers. Molecular Phylogenetics and Evolution 29: 115–119. https://doi.org/10.1016/S1055-7903(03)00074-5
  • Chapco W, Litzenberger G, Kuperus WR (2001) A molecular biogeographic analysis of the relationships between North American melanopline grasshoppers and their Eurasian and South American relatives. Molecular Phylogenetics and Evolution 18: 460–466. https://doi.org/10.1006/mpev.2000.0902
  • Chintauan-Marquier IC, Jordan S, Berthier P, Amédégnato C, Pompanon F (2011) Evolutionary history and taxonomy of a short-horned grasshopper subfamily: The Melanoplinae (Orthoptera: Acrididae). Molecular Phylogenetics and Evolution 58: 22–32. https://doi.org/10.1016/j.ympev.2010.07.003
  • Chintauan-Marquier IC, Amédégnato C, Nichols RA, Pompanon F, Grandcolas P, Desutter-Grandcolas L (2014) Inside the Melanoplinae: New molecular evidence for the evolutionary history of the Eurasian Podismini (Orthoptera: Acrididae). Molecular Phylogenetics and Evolution 71: 224–233. https://doi.org/10.1016/j.ympev.2013.09.009
  • Colombo P, Cigliano MM, Sequeira AS, Lange CE, Vilardi JC, Confalonieri VA (2005) Phylogenetic relationships in Dichroplus Stål (Orthoptera: Acrididae: Melanoplinae) inferred from molecular and morphological data: testing karyotype diversification. Cladistics 21: 375–389. https://doi.org/10.1111/j.1096-0031.2005.00068.x
  • Darriba D, Taboada GL, Doallo R, Posada D (2013) jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772. https://doi.org/10.1038/nmeth.2109
  • Dinghi PA, Confalonieri V, Cigliano MM (2009) Phylogenetic studies in the South American tribe Dichroplini (Orthoptera: Acrididae: Melanoplinae): is the Paranaense-Pampeano informal genus group a natural clade? Zootaxa 2174: 51–62.
  • Dobson M, Kawamura Y (1998) Origin of the Japanese land mammal fauna: Allocation of extant species to historically-based categories. Daiyonki Kenkyu (The Quaternary Research) 37: 385–395. https://doi.org/10.4116/jaqua.37.385
  • Hebert PDN, Ratnasingham S, Zakharov EV, Telfer AC, Levesque-Beaudin V, Milton MA, Pedersen S, Janetta P, deWaard JR (2016) Counting animal species with DNA barcodes: Canadian insects. Philosophical Transactions of the Royal Society B 371. https://doi.org/10.1098/rstb.2015.0333
  • Huang J, Zhang A, Mao S, Huang Y (2013) DNA barcoding and species boundary delimitation of selected species of Chinese Acridoidea (Orthoptera: Caelifera). PLoS ONE 8: e82400. https://doi.org/10.1371/journal.pone.0082400
  • Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294: 2310–2314. https://doi.org/10.1126/science.1065889
  • Iijima A, Tada R (1990) Evolution of Tertiary sedimentary basins of Japan in reference to opening of the Japan Sea. Journal of the Faculty of Science. University of Tokyo, Section 2: Geology, Mineralogy, Geography, Geophysics 22: 121–171.
  • Inoue M (1985) A taxonomic revision of Japanese Acridoidea (Orthoptera) with special reference to their karymorphology. Transactions Shikoku Entomological Society 17: 103–183.
  • Ito G (2015) A systematic study of the grasshopper tribe Podismini in Japan (Orthoptera: Acrididae). Insecta Matsumurana New Series 71: 1–119.
  • Kang AR, Kim MJ, Park IA, Kim KY, Kim I (2016) Extent and divergence of heteroplasmy of the DNA barcoding region in Anapodisma miramae (Orthoptera: Acrididae). Mitochondrial DNA 27: 3405–3414.
  • Kawakami Y (1999) Geographic variation of the brachypterous grasshopper Parapodisma setouchiensis group in Western Honshu, with its taxonomic revision. Species Diversity 4: 43–61.
  • Kawakami Y, Tatsuta H (2010) Variation in the shape of genital appendages along transect of sympatric and allopatric area of two brachypterous grasshoppers, Parapodisma setouchiensis and P. subastris (Orthoptera: Podisminae). Annals of the Entomological Society of America 103: 327–331. https://doi.org/10.1603/AN09074
  • Lü H-J, Huang Y (2012) Phylogenetic relationship among some groups of orthopteran based on complete sequences of the mitochondrial COI gene. Zoological Research 33: 319–328. https://doi.org/10.3724/SP.J.1141.2012.03319
  • Posada D, Buckley TR (2004) Model selection and model averaging in phylogenetics: advantages of the AIC and Bayesian approaches over likelihood ratio tests. Systematic Biology 53: 793–808. https://doi.org/10.1080/10635150490522304
  • Rambaut A, Drummond A (2012) FigTree: Tree Figure Drawing Tool, v1.4.2. Institute of Evolutionary Biology, University of Edinburgh.
  • Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America 74: 5463–5467. https://doi.org/10.1073/pnas.74.12.5463
  • Song H, Buhay JE, Whiting MF, Crandall KA (2008) Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. Proceedings of the National Academy of Sciences of the United States of America 105: 13486–13491. https://doi.org/10.1073/pnas.0803076105
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution 30: 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Vickery VR (1977) The value of cytology in taxonomy with particular reference to the Podismini (Acridoidea: Acrididae: Melanoplinae). Revista de la Sociedada Entomologica Argentina 36: 89–95.
  • Vickery VR (1987) The orthopteroid insects in northern North America: updating and rationalizing recent works. The Canadian Entomologist 19: 1043–1054. https://doi.org/10.4039/Ent1191043-11
  • Woller DA, Fontana P, Marińo-Pérez R, Song H (2014) Studies in Mexican Grasshoppers: Liladownsia fraile, a new genus and species of Dactylotini (Acrididae: Melanoplinae) and an updated molecular phylogeny of Melanoplinae. Zootaxa 3793: 475–495. https://doi.org/10.11646/zootaxa.3793.4.6
  • Yonekura N, Kaizuka S, Nogami M, Chinzei K (2001) Introduction to Japanese geomorphology. Regional Geomorphology of the Japanese Islands, 1. University of Tokyo Press, 349 pp. [In Japanese]